ENSDARG00000027310

Ensembl ID:
ENSDARG00000027310
Human Orthologues:
AC026150.5, AC091304.2, AC100756.2, AC135983.4, AC138749.1, CALD1, GOLGA6L1, GOLGA6L2, GOLGA6L6
Human Descriptions:
caldesmon 1 [Source:HGNC Symbol;Acc:1441]
golgin A6 family-like 1 [Source:HGNC Symbol;Acc:37444]
golgin A6 family-like 2 [Source:HGNC Symbol;Acc:26695]
golgin A6 family-like 6 [Source:HGNC Symbol;Acc:37225]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9IYW0]
Mouse Orthologue:
Cald1
Mouse Description:
caldesmon 1 Gene [Source:MGI Symbol;Acc:MGI:88250]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12994 Nonsense Available for shipment Available now
sa19369 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12994
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067030 Nonsense 46 568 2 13
Genomic Location:
Chromosome 25 (position 32186834)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCTGAGGAGATTGAGAGAGAAAGGCGCCGTCGGGCCCGGGAGGCTTTC[C/T]GAAATCAGCACAGCCTGTCTGGATCTGCTGGATCCCCTCAGGASARCGYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19369
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067030 Nonsense 320 568 5 13
Genomic Location:
Chromosome 25 (position 32200828)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCCGTGAAGAAGAAGAGCGGAGGAGAGAGGAAGAGGAACAGCTGAAG[C/T]AGACCAAAAAAGAGGTGGCTGAGATAAACAGAAATACTAGCCTATTCTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k1er36lp