nrp1b

Ensembl ID:
ENSDARG00000027290
ZFIN ID:
ZDB-GENE-040611-1
Description:
neuropilin 1b [Source:RefSeq peptide;Acc:NP_991237]
Human Orthologue:
NRP1
Human Description:
neuropilin 1 [Source:HGNC Symbol;Acc:8004]
Mouse Orthologue:
Nrp1
Mouse Description:
neuropilin 1 Gene [Source:MGI Symbol;Acc:MGI:106206]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19852 Nonsense Available for shipment Available now
sa9247 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19852
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098265 Nonsense 769 871 14 17
ENSDART00000098267 Nonsense 769 959 14 17
ENSDART00000142078   None 327 None 6
Genomic Location (Zv9):
Chromosome 2 (position 43626219)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43675683
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCACAGGTCACTGCTCCAGATTCAGACCTATGCATGTCCTTTTGGTA[T/G]CACTTCACTGAGAAGCACGCGGGAACGCTGAACATTAAGCAGAAGGTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9247
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098265 Nonsense 808 871 14 17
ENSDART00000098267 Nonsense 808 959 14 17
ENSDART00000142078   None 327 None 6
Genomic Location (Zv9):
Chromosome 2 (position 43626334)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43675798
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAGGAACGAGAGATTCTGATCCGCTTGCTGAACGGCCAGACCAAAAGC[A/T]GATGGAGGGAAGGAAGAGTTCTGCTTCCCAGCGCAGACACACCGTACCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link