btg1

Ensembl ID:
ENSDARG00000027249
ZFIN ID:
ZDB-GENE-010726-1
Description:
protein BTG1 [Source:RefSeq peptide;Acc:NP_956314]
Human Orthologue:
BTG1
Human Description:
B-cell translocation gene 1, anti-proliferative [Source:HGNC Symbol;Acc:1130]
Mouse Orthologues:
4930430D24Rik, 4930525M21Rik, Btg1
Mouse Descriptions:
B-cell translocation gene 1, anti-proliferative Gene [Source:MGI Symbol;Acc:MGI:88215]
RIKEN cDNA 4930430D24 gene Gene [Source:MGI Symbol;Acc:MGI:3588265]
RIKEN cDNA 4930525M21 gene Gene [Source:MGI Symbol;Acc:MGI:3588262]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12374 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12374
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033188 Essential Splice Site 48 182 1 2
Genomic Location:
Chromosome 4 (position 15612901)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGACAGACAGCTCCAGACATTCAGCCAGACCCTACAGGACATCCTGGCAG[G/A]TAATTAWCCACATTTATAAACGAATACGAGCTTCGTTGTATCCGCTTTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Heart failure: Association of genome-wide variation with the risk of incident heart failure in adults of European and African ancestry: a prospective meta-analysis from the cohorts for heart and aging research in genomic epidemiology (CHARGE) consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3kaewlre