ift88

Ensembl ID:
ENSDARG00000027234
ZFIN ID:
ZDB-GENE-030131-574
Description:
intraflagellar transport protein 88 homolog [Source:RefSeq peptide;Acc:NP_001001725]
Human Orthologue:
IFT88
Human Description:
intraflagellar transport 88 homolog (Chlamydomonas) [Source:HGNC Symbol;Acc:20606]
Mouse Orthologue:
Ift88
Mouse Description:
intraflagellar transport 88 homolog (Chlamydomonas) Gene [Source:MGI Symbol;Acc:MGI:98715]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41401 Essential Splice Site Mutation detected in F1 DNA During 2017
sa27381 Nonsense Mutation detected in F1 DNA During 2017
sa7628 Missense Mutation detected in F1 DNA During 2017
sa18944 Nonsense Mutation detected in F1 DNA During 2017
sa8799 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41401
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038923 Essential Splice Site 163 824 8 26
ENSDART00000110943 Essential Splice Site 163 855 7 27
ENSDART00000132032   None 109 None 4
Genomic Location (Zv9):
Chromosome 9 (position 22413917)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21569703
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGATAGAGGATAGCTGTCTTGCTCATGCACGTGGAGATCTTCAGGTG[G/A]TGGGTATAGCTCGGAAACAGTTCTTTGACCTTTTAGAATGAATATTTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27381
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038923 Nonsense 207 824 10 26
ENSDART00000110943 Nonsense 207 855 9 27
ENSDART00000132032   None 109 None 4
Genomic Location (Zv9):
Chromosome 9 (position 22413630)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21569416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGTCTTTTATGCATTGTACAGGTGCTGTTTAATTTAGCAAATCAGTA[T/A]GCCAACAATGACATGTACACCGAGGCCTTGAACACTTACCAAGTCATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7628
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038923 Missense 223 824 10 26
ENSDART00000110943 Missense 223 855 9 27
ENSDART00000132032   None 109 None 4
Genomic Location (Zv9):
Chromosome 9 (position 22413583)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21569369
KASP Assay ID:
554-4219.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATGCCAACAATGACATGTACACCGAGGCCTTGAACACTTACCAAGTCA[T/C]TGTGAAGAACAAAATGTTCAATAATGCAGGTGAGCGAGTTTTTAAGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18944
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038923 Nonsense 262 824 11 26
ENSDART00000110943 Nonsense 262 855 10 27
ENSDART00000132032   None 109 None 4
ENSDART00000038923 Nonsense 262 824 11 26
ENSDART00000110943 Nonsense 262 855 10 27
ENSDART00000132032   None 109 None 4
Genomic Location (Zv9):
Chromosome 9 (position 22412602)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21568388
KASP Assay ID:
2260-1733.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAAAAGAACTATACAAAGGCTATTAAATTTTATCGCATGGCTTTGGAT[C/T]AGATTTCAAATGCCCACAATGCAATGAGGTTGGTACTTTAGTGCATTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8799
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038923 Nonsense 262 824 11 26
ENSDART00000110943 Nonsense 262 855 10 27
ENSDART00000132032   None 109 None 4
ENSDART00000038923 Nonsense 262 824 11 26
ENSDART00000110943 Nonsense 262 855 10 27
ENSDART00000132032   None 109 None 4
Genomic Location (Zv9):
Chromosome 9 (position 22412602)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21568388
KASP Assay ID:
2260-1733.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAAAAGAACTATACAAAGGCTATTAAATTTTATCGCATGGCTTTGGAT[C/T]AGATTTCAAATGCCCACAATGCAATGAGGTTGGTACTTTAGTGSATTTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link