si:ch211-130o18.2

Ensembl ID:
ENSDARG00000027192
ZFIN ID:
ZDB-GENE-060503-193
Description:
Novel protein similar to vertebrate hyperpolarization activated cyclic nucleotide-gated potassium ch
Human Orthologue:
HCN3
Human Description:
hyperpolarization activated cyclic nucleotide-gated potassium channel 3 [Source:HGNC Symbol;Acc:1918
Mouse Orthologue:
Hcn3
Mouse Description:
hyperpolarization-activated, cyclic nucleotide-gated K+ 3 Gene [Source:MGI Symbol;Acc:MGI:1298211]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25085 Nonsense Mutation detected in F1 DNA During 2017
sa6545 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25085
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039325 Nonsense 247 639 2 7
Genomic Location (Zv9):
Chromosome 19 (position 9822878)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9281417
KASP Assay ID:
554-7763.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAATCATCCTAGACCCGCAAATCATCAGCCGGCGTTACCTGCGAGGATG[G/A]TTCCTGGTGGACTTCATCTCCTCCATACCAGTGGACTACATCTTCCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6545
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039325 Essential Splice Site 439 639 4 7
Genomic Location (Zv9):
Chromosome 19 (position 9827634)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9286173
KASP Assay ID:
554-5427.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAACCTGGTCCAGTCTTTRGATGCTTCCCATCGTCAGTACCAAGAAAAG[G/A]TACAAGCTRATAAGTTAAGSCTTTTTGAGACATCGTTTTCTTCTTTTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link