myst1

Ensembl ID:
ENSDARG00000027187
ZFIN ID:
ZDB-GENE-030131-7510
Description:
probable histone acetyltransferase MYST1 [Source:RefSeq peptide;Acc:NP_997907]
Human Orthologue:
MYST1
Human Description:
MYST histone acetyltransferase 1 [Source:HGNC Symbol;Acc:17933]
Mouse Orthologue:
Myst1
Mouse Description:
MYST histone acetyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1915023]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33219 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33219
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028238 Essential Splice Site 365 487 9 11
ENSDART00000140290 Essential Splice Site 380 502 9 11

The following transcripts of ENSDARG00000027187 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 32823075)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32554385
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGACCCTTTCTGGATAGATAACTTTTTCTTGTGTCATGATTTTTCTCA[G/A]GTTATGAGTTATCTAAGCTGGAAAGCACAGTGGGCTCTCCAGAGAAGCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link