si:ch211-178h7.5

Ensembl ID:
ENSDARG00000027159
ZFIN IDs:
ZDB-GENE-030131-4665, ZDB-GENE-030131-4665, ZDB-GENE-081107-16
Description:
Novel protein similar to vertebrate F-box protein 28 (FBXO28) [Source:UniProtKB/TrEMBL;Acc:B8A499]
Human Orthologue:
FBXO28
Human Description:
F-box protein 28 [Source:HGNC Symbol;Acc:29046]
Mouse Orthologue:
Fbxo28
Mouse Description:
F-box protein 28 Gene [Source:MGI Symbol;Acc:MGI:1261890]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42105 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42105
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032262 Nonsense 319 394 5 5
ENSDART00000134884 Nonsense 271 346 5 5
Genomic Location (Zv9):
Chromosome 13 (position 362065)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 360048
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCTCTGCGGCGCGAGATGCAGGAGGTGCGTCTGAAGCAGCTGGAGCAG[C/T]AGAAGCAGCTGCAGGACCAGGAGCAGAAGCTGCAGGAGCAGTCGCAGGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link