tpd52l2a

Ensembl ID:
ENSDARG00000027154
ZFIN ID:
ZDB-GENE-030131-7047
Description:
tumor protein D52-like 2a [Source:RefSeq peptide;Acc:NP_997898]
Human Orthologues:
TPD52L2, TPD52L3
Human Descriptions:
tumor protein D52-like 2 [Source:HGNC Symbol;Acc:12007]
tumor protein D52-like 3 [Source:HGNC Symbol;Acc:23382]
Mouse Orthologues:
Tpd52l2, Trpd52l3
Mouse Descriptions:
tumor protein D52-like 2 Gene [Source:MGI Symbol;Acc:MGI:1913564]
tumor protein D52-like 3 Gene [Source:MGI Symbol;Acc:MGI:1913995]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21281 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21281
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028946 Nonsense 105 176 5 7
ENSDART00000136914 Nonsense 125 180 6 8
ENSDART00000137815 Nonsense 125 196 6 8
ENSDART00000144855 Nonsense 105 199 5 9

The following transcripts of ENSDARG00000027154 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 24055613)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGACAACTGCTAAAAGGAGAAGTGCTTGTGTGTTGTTTCTGTAGCTA[T/A]AAGAGGACTCAGGAGACTCTCTCTCAGGCCGGTCAGGTGACATCAGCTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/i14c3yk7