ephb4b

Ensembl ID:
ENSDARG00000027112
ZFIN ID:
ZDB-GENE-990415-65
Description:
eph receptor B4b [Source:RefSeq peptide;Acc:NP_571492]
Human Orthologue:
EPHB4
Human Description:
EPH receptor B4 [Source:HGNC Symbol;Acc:3395]
Mouse Orthologue:
Ephb4
Mouse Description:
Eph receptor B4 Gene [Source:MGI Symbol;Acc:MGI:104757]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37794 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37794
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097644 Essential Splice Site 826 976 14 17
ENSDART00000136056 Essential Splice Site 683 833 11 14
Genomic Location (Zv9):
Chromosome 23 (position 44523858)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44591648
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGATGTCATTCGGAGAGAGGCCGTACTGGGACATGAGCAACCAGGAC[G/A]TGAGTGACCACAGCTGAAAGAGTGTGTGTGTGTGTGTTTGTGTGTGTTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link