psmc4

Ensembl ID:
ENSDARG00000027099
ZFIN ID:
ZDB-GENE-030131-5083
Description:
proteasome 26S subunit, ATPase, 4 [Source:RefSeq peptide;Acc:NP_956044]
Human Orthologue:
PSMC4
Human Description:
proteasome (prosome, macropain) 26S subunit, ATPase, 4 [Source:HGNC Symbol;Acc:9551]
Mouse Orthologue:
Psmc4
Mouse Description:
proteasome (prosome, macropain) 26S subunit, ATPase, 4 Gene [Source:MGI Symbol;Acc:MGI:1346093]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42793 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14104 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42793
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034078 Essential Splice Site 12 418 1 11
ENSDART00000134718   None 75 None 3
Genomic Location (Zv9):
Chromosome 16 (position 44574277)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41854785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTACAAGCAAACATGGAGGACGGTGGAGTGTTGGTTGAGAAACCTCAGG[T/C]GAGATCTTATGATGTAATTTTAACAATTTTACTCTTACAAGGCTGGCCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14104
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034078 Essential Splice Site 382 418 11 11
ENSDART00000134718   None 75 None 3
Genomic Location (Zv9):
Chromosome 16 (position 44564587)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41845095
KASP Assay ID:
2261-0190.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAAATTTTATGGTTTGTTTACACTGAATCCTCCTTTCTCTTTTAWACR[G/A]GCCGGTATGCTGGCTGTGCGTGAAAACCGCTACATTGTGCTGGCCAAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link