hmbox1a

Ensembl ID:
ENSDARG00000027082
ZFIN ID:
ZDB-GENE-050913-89
Description:
homeobox containing 1a [Source:RefSeq peptide;Acc:NP_001025435]
Human Orthologue:
HMBOX1
Human Description:
homeobox containing 1 [Source:HGNC Symbol;Acc:26137]
Mouse Orthologue:
Hmbox1
Mouse Description:
homeobox containing 1 Gene [Source:MGI Symbol;Acc:MGI:2445066]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14163 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14163
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030835 Essential Splice Site 244 441 5 9
Genomic Location:
Chromosome 17 (position 16145011)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGTGTCCTCWTGCTTCACCTGAGCTGATGTGATGATTTTTGTGTCTY[A/C]GGTGCGACTCTAGCGATGCGTCCCACACCGATGGCCCTGGAGGACATTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vt8xxeow