c2orf24

Ensembl ID:
ENSDARG00000027078
ZFIN ID:
ZDB-GENE-030131-6808
Description:
hypothetical protein LOC334868 [Source:RefSeq peptide;Acc:NP_956222]
Human Orthologue:
C2orf24
Human Description:
chromosome 2 open reading frame 24 [Source:HGNC Symbol;Acc:25220]
Mouse Orthologue:
1810031K17Rik
Mouse Description:
RIKEN cDNA 1810031K17 gene Gene [Source:MGI Symbol;Acc:MGI:1916421]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1384 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa1384
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037036 Essential Splice Site 166 427 5 8

The following transcripts of ENSDARG00000027078 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 5030215)
KASP Assay ID:
554-1296.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACGTTCAGACTGTCAACACTCTGGAGATGAACTTCCTCAATGCGATTG[T/C]AAGYGTGACCTTCCACCCTTCCAAAGTACTGAAGGTTGTTTTGCGTTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gylse2vr