Q6NW74_DANRE

Ensembl ID:
ENSDARG00000027075
Description:
LOC407698 protein [Source:UniProtKB/TrEMBL;Acc:Q6NW74]
Human Orthologue:
ANO1
Human Description:
anoctamin 1, calcium activated chloride channel [Source:HGNC Symbol;Acc:21625]
Mouse Orthologue:
Ano1
Mouse Description:
anoctamin 1, calcium activated chloride channel Gene [Source:MGI Symbol;Acc:MGI:2142149]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34191 Essential Splice Site Mutation detected in F1 DNA During 2017
sa7087 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34191
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003385   None 891 None 23
ENSDART00000127273 Essential Splice Site 443 861 15 24
Genomic Location (Zv9):
Chromosome 7 (position 54980222)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAGTACTTCACCAGCACTTTATCTATCTATCTATCTCTCTATCTATTG[G/A]TCTGTTGTTGTTGTGGAGGTCTGGGAGATTCCCGTTCTCTCTTCCTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7087
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003385 Nonsense 642 891 18 23
ENSDART00000127273 Nonsense 633 861 19 24
Genomic Location (Zv9):
Chromosome 7 (position 54984741)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 54069769
KASP Assay ID:
554-4820.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATTGACCCAAAGCACCAGGAAGAGCTGAACAAAACGCTTCATCGCCAT[G/T]AGAAGGACCACTTCCTAGGACCCTTTGTCGGWCTCAACCCAGAGTACATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link