scyl3

Ensembl ID:
ENSDARG00000027046
ZFIN ID:
ZDB-GENE-030131-2559
Description:
protein-associating with the carboxyl-terminal domain of ezrin [Source:RefSeq peptide;Acc:NP_955951
Human Orthologue:
SCYL3
Human Description:
SCY1-like 3 (S. cerevisiae) [Source:HGNC Symbol;Acc:19285]
Mouse Orthologue:
Scyl3
Mouse Description:
SCY1-like 3 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1921385]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3082 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa3082
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033817 Essential Splice Site 319 768 9 14
ENSDART00000125213 Essential Splice Site 319 768 8 13
Genomic Location (Zv9):
Chromosome 20 (position 34045717)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34118230
KASP Assay ID:
554-3213.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCATGGCTGTGAAAAGCTTTCTTCCTCACCTTTTGCAGCCTAAGCAAGG[T/C]AGAAACAGCCAGTAAAGATGCTCAAAGTGCACATTACCCAGGCGTGATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link