pcdh17

Ensembl ID:
ENSDARG00000027041
ZFIN ID:
ZDB-GENE-090608-3
Description:
Protocadherin-17 [Source:UniProtKB/TrEMBL;Acc:C4P342]
Human Orthologue:
PCDH17
Human Description:
protocadherin 17 [Source:HGNC Symbol;Acc:14267]
Mouse Orthologue:
Pcdh17
Mouse Description:
protocadherin 17 Gene [Source:MGI Symbol;Acc:MGI:2684924]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38852 Nonsense Mutation detected in F1 DNA During 2017
sa41877 Nonsense Mutation detected in F1 DNA During 2017
sa41876 Nonsense Mutation detected in F1 DNA During 2017
sa16710 Nonsense Available for shipment Available now
sa11699 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38852
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125630 Nonsense 267 1137 1 4
Genomic Location (Zv9):
Chromosome 11 (position 33534703)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 32458751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTAATAATAGATTTAAATGCTACAGATTCTGATGAAGGGATTAATGGG[C/T]AGGTTACTTATTCTTTTAGCTGTTATGTCCCAGACAGGATCAAAGAGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41877
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125630 Nonsense 283 1137 1 4
Genomic Location (Zv9):
Chromosome 11 (position 33534654)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 32458702
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGTTACTTATTCTTTTAGCTGTTATGTCCCAGACAGGATCAAAGAGT[T/A]GTTTTCAATAGACCCACGAACTGGTGTCATAAAGATTCAGGGTAAAATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41876
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125630 Nonsense 842 1137 2 4
Genomic Location (Zv9):
Chromosome 11 (position 33467871)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 32391919
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCACAGACAGACAATTTTCCTGCTGAGCCCAATTACATGGGTAACAGG[C/T]AGCAGTTTGTTCAAAGGTAAGGCCTATTTAACAGTTTTCTCAGCGTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16710
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125630 Nonsense 843 1137 2 4
Genomic Location (Zv9):
Chromosome 11 (position 33467868)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 32391916
KASP Assay ID:
2260-4482.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGACAGACAATTTTCCTGCTGAGCCCAATTACATGGGTAACAGGCAG[C/T]AGTTTGTTCAAAGGTAAGGCCTATTTAACAGTTTTCTCAGCGTTATTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11699
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125630 Nonsense 849 1137 3 4
Genomic Location (Zv9):
Chromosome 11 (position 33467705)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 32391753
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCTTTTTTTTTTTTTTTGGTCTTGTTGTTTTTTGGACTTGTAGCAGCT[C/A]AACGTTCAAAGATCCAGAGCGTGCCAGTCTCAGAGACAGCGGACACGGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link