ppp2r5a

Ensembl ID:
ENSDARG00000027017
ZFIN ID:
ZDB-GENE-040724-174
Description:
Novel protein similar to phosphatase 2 regulatory subunit B (B56) family [Source:UniProtKB/TrEMBL;Ac
Human Orthologue:
PPP2R5A
Human Description:
protein phosphatase 2, regulatory subunit B', alpha [Source:HGNC Symbol;Acc:9309]
Mouse Orthologue:
Ppp2r5a
Mouse Description:
protein phosphatase 2, regulatory subunit B (B56), alpha isoform Gene [Source:MGI Symbol;Acc:MGI:238

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29321 Nonsense Mutation detected in F1 DNA During 2017
sa23647 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29321
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025644 Nonsense 98 455 2 13
Genomic Location (Zv9):
Chromosome 20 (position 13149832)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13339078
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAAGAGCAAAGAGACCAAACGGGCCACTCTCAGCGAACTCGTGGATTA[T/G]GTGTCCACTAACAGAGGCGTTCTGGTGGAGCCCGTCTATCCCGAAATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23647
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025644 Splice Site, Nonsense 356 455 10 13
Genomic Location (Zv9):
Chromosome 20 (position 13218693)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13407939
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGCCTTTATTTAAGCAAATCGCTAAATGTGTAGCCAGCCCTCATTTT[C/T]AGGTACTGTGGAAAACCAGAGTATACTTTAAATGCAGATACACACACACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link