si:dkey-183c23.1

Ensembl ID:
ENSDARG00000027016
ZFIN ID:
ZDB-GENE-081107-54
Description:
Novel protein similar to vertebrate golgi-specific brefeldin A resistance factor 1 (GBF1) [Source:Un
Human Orthologue:
GBF1
Human Description:
golgi brefeldin A resistant guanine nucleotide exchange factor 1 [Source:HGNC Symbol;Acc:4181]
Mouse Orthologue:
Gbf1
Mouse Description:
golgi-specific brefeldin A-resistance factor 1 Gene [Source:MGI Symbol;Acc:MGI:1861607]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12707 Nonsense Available for shipment Available now
sa18494 Nonsense Available for shipment Available now
sa9693 Nonsense Available for shipment Available now
sa14258 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12707
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046792 Nonsense 154 1786 5 38
ENSDART00000141695 Nonsense 206 601 8 15
ENSDART00000146592   None 1177 None 24
Genomic Location (Zv9):
Chromosome 13 (position 6555601)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7348759
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACGTGTGTCTCTGCAGATTGCCACAGTTCAAAGAGGAGGCCAAGAGTTA[T/A]GTGGGCACTAACATGAAGAAGGTAAATATRAAATCCTTTTTGCTATCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046792 Nonsense 740 1786 16 38
ENSDART00000141695   None 601 None 15
ENSDART00000146592 Nonsense 129 1177 3 24
Genomic Location (Zv9):
Chromosome 13 (position 6533905)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7370455
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTGTATCTGGAGGCTTTCCGTCTTCCTGGCGAAGCGCCTGTCATTCAT[C/T]GACTTTTGGAAACCTTCACYGACAACTGGCATGTAAGTCAGCTGCCACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9693
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046792 Nonsense 768 1786 17 38
ENSDART00000141695   None 601 None 15
ENSDART00000146592 Nonsense 157 1177 4 24
Genomic Location (Zv9):
Chromosome 13 (position 6533107)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7371253
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAACGGTAATCCCTTCCAGACAAATGACGCTGGCTTCGCCCTGGCTTA[C/A]GCCGTGATCATGYTWAACACCGATCAGCACAACCATAACGTTCGAAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14258
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046792 Essential Splice Site 820 1786 18 38
ENSDART00000141695   None 601 None 15
ENSDART00000146592 Essential Splice Site 209 1177 5 24
Genomic Location (Zv9):
Chromosome 13 (position 6528945)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7375415
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAATGACTTTGATCAAGATATGCTGGAAGACATCTACAATGCCATCAAG[T/C]TAGTGCTCATTGTCTTGTTGTTCTCTTGCAGTTGTTGCTCTTTCTAATRC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link