klhl6

Ensembl ID:
ENSDARG00000026990
ZFIN ID:
ZDB-GENE-030616-325
Description:
kelch-like protein 6 isoform 1 [Source:RefSeq peptide;Acc:NP_001005316]
Human Orthologue:
KLHL6
Human Description:
kelch-like 6 (Drosophila) [Source:HGNC Symbol;Acc:18653]
Mouse Orthologue:
Klhl6
Mouse Description:
kelch-like 6 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2686922]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32964 Nonsense Mutation detected in F1 DNA During 2017
sa39880 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32964
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039174 Nonsense 385 614 5 7

The following transcripts of ENSDARG00000026990 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 36374854)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36671564
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTATTTTAAAACTTAAAACAGGTGGCAAGGAAACTCTGCATGATGTGTG[G/A]AAGTATAATGCATCACTGAACAAATGGATCCAGATTGAGTTCCTCAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39880
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039174 Nonsense 480 614 6 7

The following transcripts of ENSDARG00000026990 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 36376207)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36672917
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTACGTGATTGGTGGAGGTCCTAATGGCAAGCTGGCCACAAACAACATG[C/T]AGTGCTTCGACTCACAATCAAATAAATGGAGCCTTAAGTGTCCGATGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link