tbc1d22b

Ensembl ID:
ENSDARG00000026988
ZFIN ID:
ZDB-GENE-091118-28
Human Orthologue:
TBC1D22B
Human Description:
TBC1 domain family, member 22B [Source:HGNC Symbol;Acc:21602]
Mouse Orthologue:
Tbc1d22b
Mouse Description:
TBC1 domain family, member 22B Gene [Source:MGI Symbol;Acc:MGI:2681867]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9032 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9032
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098009 Nonsense 299 399 7 10
ENSDART00000132253 Nonsense 299 418 7 9
Genomic Location:
Chromosome 8 (position 10834579)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGAGCGGATTCTGTTCATCTGGGCCATCCGTCACCCYGCTAGCGGATA[C/A]GTGCAGGGCATTAATGACCTGGTCACTCCCTTTTTTGTGGTCTTCCTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7ble9fvj