rexo1

Ensembl ID:
ENSDARG00000026986
ZFIN ID:
ZDB-GENE-030131-1650
Description:
RNA exonuclease 1 homolog [Source:RefSeq peptide;Acc:NP_001119888]
Human Orthologues:
AC093331.1, AC232323.1, REXO1, REXO1L1, REXO1L2P, REXO1L2P, REXO1L2P, REXO1L2P, REXO1L2P, REXO1L2P, REXO1L8
Human Descriptions:
REX1, RNA exonuclease 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:24616]
REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 1 [Source:HGNC Symbol;Acc:24660]
REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 2 (pseudogene) [Source:HGNC Symbol;Acc:32239]
REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 2 (pseudogene) [Source:HGNC Symbol;Acc:32239]
REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 2 (pseudogene) [Source:HGNC Symbol;Acc:32239]
REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 2 (pseudogene) [Source:HGNC Symbol;Acc:32239]
REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 2 (pseudogene) [Source:HGNC Symbol;Acc:32239]
REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 2 (pseudogene) [Source:HGNC Symbol;Acc:32239]
REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 8 [Source:HGNC Symbol;Acc:35429]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9J7R2]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9JBR2]
Mouse Orthologue:
Rexo1
Mouse Description:
REX1, RNA exonuclease 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1914182]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21263 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21263
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079618 Nonsense 820 1207 6 16
ENSDART00000121610 Nonsense 812 1200 7 17
Genomic Location (Zv9):
Chromosome 8 (position 21000671)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20430568
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTACCTTAACATCTTCATCGATGAGTGCCTGAAGTTCTGCTCCTCTGAA[C/T]AGGACGCTTTCCAATTAGTGAGCCATACAGCTTTCACAATTTCATTTCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link