rexo1

Ensembl ID:
ENSDARG00000026986
ZFIN ID:
ZDB-GENE-030131-1650
Description:
RNA exonuclease 1 homolog [Source:RefSeq peptide;Acc:NP_001119888]
Human Orthologues:
AC093331.1, AC232323.1, REXO1, REXO1L1, REXO1L2P, REXO1L2P, REXO1L2P, REXO1L2P, REXO1L2P, REXO1L2P, REXO1L8
Human Descriptions:
REX1, RNA exonuclease 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:24616]
REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 1 [Source:HGNC Symbol;Acc:24660]
REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 2 (pseudogene) [Source:HGNC Symbol;Acc:32239]
REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 2 (pseudogene) [Source:HGNC Symbol;Acc:32239]
REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 2 (pseudogene) [Source:HGNC Symbol;Acc:32239]
REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 2 (pseudogene) [Source:HGNC Symbol;Acc:32239]
REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 2 (pseudogene) [Source:HGNC Symbol;Acc:32239]
REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 2 (pseudogene) [Source:HGNC Symbol;Acc:32239]
REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 8 [Source:HGNC Symbol;Acc:35429]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9J7R2]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9JBR2]
Mouse Orthologue:
Rexo1
Mouse Description:
REX1, RNA exonuclease 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1914182]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21263 Nonsense Available for shipment Available now
sa44684 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21263
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079618 Nonsense 820 1207 6 16
ENSDART00000121610 Nonsense 812 1200 7 17
Genomic Location (Zv9):
Chromosome 8 (position 21000671)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20430568
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTACCTTAACATCTTCATCGATGAGTGCCTGAAGTTCTGCTCCTCTGAA[C/T]AGGACGCTTTCCAATTAGTGAGCCATACAGCTTTCACAATTTCATTTCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44684
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079618 Essential Splice Site 1179 1207 15 16
ENSDART00000121610 Essential Splice Site 1172 1200 16 17
Genomic Location (Zv9):
Chromosome 8 (position 21006561)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCGTAACCTTATGGCCGACTACCTCAAACGCATCATCCAGGACAACGG[T/G]ACTGATCTGCATTATTATGACTAGATTTAGGTGAAGTTCACCAAAAAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link