lims1

Ensembl ID:
ENSDARG00000026985
ZFIN ID:
ZDB-GENE-050522-236
Description:
LIM and senescent cell antigen-like-containing domain protein 1 [Source:RefSeq peptide;Acc:NP_00101
Human Orthologues:
AC108938.4, LIMS1, LIMS3
Human Descriptions:
LIM and senescent cell antigen-like domains 1 [Source:HGNC Symbol;Acc:6616]
LIM and senescent cell antigen-like domains 3 [Source:HGNC Symbol;Acc:30047]
LIM and senescent cell antigen-like-containing domain protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q9H
Mouse Orthologue:
Lims1
Mouse Description:
LIM and senescent cell antigen-like domains 1 Gene [Source:MGI Symbol;Acc:MGI:1195263]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41878 Nonsense Mutation detected in F1 DNA During 2016
sa18028 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41878
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033980 Nonsense 68 336 3 10
Genomic Location:
Chromosome 11 (position 34446483)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAATGTTATGTTTGATTTTCCTTTCTTCTGTCCATAGTTTGAGGGAAGG[A/T]AGTACTGTGAGCATGATTTCCAGATGTTGTTTGCTCCCTGTTGTCACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18028
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033980 Nonsense 311 336 10 10
Genomic Location:
Chromosome 11 (position 34437603)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTTGTGTTTTAGGAACAAGTTTGTGGAGTTTGACATGAAGCCGGTGTG[T/A]AAGAAATGCTACGAGAAGTTTCCTCTGGAGCTGAAGAAGAGGCTGAAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link