si:ch211-119o8.6

Ensembl ID:
ENSDARG00000026972
ZFIN ID:
ZDB-GENE-070912-17
Description:
zinc finger protein-like [Source:RefSeq peptide;Acc:NP_001108212]
Human Orthologues:
ZNF100, ZNF117, ZNF138, ZNF141, ZNF195, ZNF254, ZNF257, ZNF273, ZNF429, ZNF43, ZNF430, ZNF431, ZNF479, ZNF492, ZNF493, ZNF506, ZNF626, ZNF66P, ZNF675, ZNF676, ZNF678, ZNF679, ZNF680, ZNF681, ZNF682, ZNF695, ZNF708, ZNF714, ZNF716, ZNF724P, ZNF726, ZNF730, ZNF732, ZNF736, ZNF737, ZNF85, ZNF90, ZNF92, ZNF98
Human Descriptions:
zinc finger protein 100 [Source:HGNC Symbol;Acc:12880]
zinc finger protein 117 [Source:HGNC Symbol;Acc:12897]
zinc finger protein 138 [Source:HGNC Symbol;Acc:12922]
zinc finger protein 141 [Source:HGNC Symbol;Acc:12926]
zinc finger protein 195 [Source:HGNC Symbol;Acc:12986]
zinc finger protein 254 [Source:HGNC Symbol;Acc:13047]
zinc finger protein 257 [Source:HGNC Symbol;Acc:13498]
zinc finger protein 273 [Source:HGNC Symbol;Acc:13067]
zinc finger protein 429 [Source:HGNC Symbol;Acc:20817]
zinc finger protein 43 [Source:HGNC Symbol;Acc:13109]
zinc finger protein 430 [Source:HGNC Symbol;Acc:20808]
zinc finger protein 431 [Source:HGNC Symbol;Acc:20809]
zinc finger protein 479 [Source:HGNC Symbol;Acc:23258]
zinc finger protein 492 [Source:HGNC Symbol;Acc:23707]
zinc finger protein 493 [Source:HGNC Symbol;Acc:23708]
zinc finger protein 506 [Source:HGNC Symbol;Acc:23780]
zinc finger protein 626 [Source:HGNC Symbol;Acc:30461]
zinc finger protein 66, pseudogene [Source:HGNC Symbol;Acc:13135]
zinc finger protein 675 [Source:HGNC Symbol;Acc:30768]
zinc finger protein 676 [Source:HGNC Symbol;Acc:20429]
zinc finger protein 678 [Source:HGNC Symbol;Acc:28652]
zinc finger protein 679 [Source:HGNC Symbol;Acc:28650]
zinc finger protein 680 [Source:HGNC Symbol;Acc:26897]
zinc finger protein 681 [Source:HGNC Symbol;Acc:26457]
zinc finger protein 682 [Source:HGNC Symbol;Acc:28857]
zinc finger protein 695 [Source:HGNC Symbol;Acc:30954]
zinc finger protein 708 [Source:HGNC Symbol;Acc:12945]
zinc finger protein 714 [Source:HGNC Symbol;Acc:27124]
zinc finger protein 716 [Source:HGNC Symbol;Acc:32458]
zinc finger protein 724, pseudogene [Source:HGNC Symbol;Acc:32460]
zinc finger protein 726 [Source:HGNC Symbol;Acc:32462]
zinc finger protein 730 [Source:HGNC Symbol;Acc:32470]
zinc finger protein 732 [Source:HGNC Symbol;Acc:37138]
zinc finger protein 736 [Source:HGNC Symbol;Acc:32467]
zinc finger protein 737 [Source:HGNC Symbol;Acc:32468]
zinc finger protein 85 [Source:HGNC Symbol;Acc:13160]
zinc finger protein 90 [Source:HGNC Symbol;Acc:13165]
zinc finger protein 92 [Source:HGNC Symbol;Acc:13168]
zinc finger protein 98 [Source:HGNC Symbol;Acc:13174]
Mouse Orthologues:
Zfp11, Zfp457, Zfp458, Zfp595, Zfp738, Zfp759
Mouse Descriptions:
zinc finger protein 11 Gene [Source:MGI Symbol;Acc:MGI:99156]
zinc finger protein 457 Gene [Source:MGI Symbol;Acc:MGI:2664334]
zinc finger protein 458 Gene [Source:MGI Symbol;Acc:MGI:3040691]
zinc finger protein 595 Gene [Source:MGI Symbol;Acc:MGI:3040707]
zinc finger protein 738 Gene [Source:MGI Symbol;Acc:MGI:3040706]
zinc finger protein 759 Gene [Source:MGI Symbol;Acc:MGI:2446280]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9237 Nonsense Mutation detected in F1 DNA During 2017
sa32988 Nonsense Mutation detected in F1 DNA During 2017
sa39896 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114085 Nonsense 298 735 4 4
ENSDART00000146812   None 218 None 5
Genomic Location (Zv9):
Chromosome 2 (position 38691001)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 39021166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACAGGAGAGAARCCGTTTTCTTGCTCGCAATGTGGGAAGAGCTTYTCT[C/T]GAAGAAGTACYCTRAACACYCAYTTGCGGTTACACATGGGCCMCCTTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32988
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114085 Nonsense 403 735 4 4
ENSDART00000146812   None 218 None 5
Genomic Location (Zv9):
Chromosome 2 (position 38690684)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 39020849
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTTCACCAGACTATTCACCAAGACAAACGTTCCTTTCATTGCACCTA[C/A]TGCGATAATAGCTTCAAAAGGCTGAGCCACCTCACGTCACACCTGAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39896
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114085 Nonsense 569 735 4 4
ENSDART00000146812   None 218 None 5
Genomic Location (Zv9):
Chromosome 2 (position 38690186)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 39020351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTCAAGAGCCACATGATAATCCATTCCAGCAAGACCCTTTTAGACTG[C/A]ACCACCTGTGGCAAAACCTTCACTCGCCATGACACCTTGAAAAGGCATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link