hk2

Ensembl ID:
ENSDARG00000026964
ZFIN ID:
ZDB-GENE-040426-2017
Description:
hexokinase-2 [Source:RefSeq peptide;Acc:NP_998231]
Human Orthologue:
HK2
Human Description:
hexokinase 2 [Source:HGNC Symbol;Acc:4923]
Mouse Orthologue:
Hk2
Mouse Description:
hexokinase 2 Gene [Source:MGI Symbol;Acc:MGI:1315197]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40376 Nonsense Mutation detected in F1 DNA During 2017
sa33551 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40376
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032042 Nonsense 688 919 15 18
ENSDART00000057637 Nonsense 688 919 15 18
ENSDART00000128401 Nonsense 691 922 16 19
Genomic Location (Zv9):
Chromosome 5 (position 15367913)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 13478738
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTAAATGCGTTATGTCTATCCTATAGGTACGGGAACTAATGCGTGCTA[C/A]ATGGAGGAGATGTCAAACGTTGAGCTGGTGGATGGAGATGAAGGCCGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032042 Nonsense 913 919 18 18
ENSDART00000057637 Nonsense 913 919 18 18
ENSDART00000128401 Nonsense 916 922 19 19
Genomic Location (Zv9):
Chromosome 5 (position 15393698)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 13503626
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAGACGGCAGTGGAAAAGGTGCTGCCCTCATCACAGCGGTGGCCTGT[C/T]GATTAAGAGATGCGGGGAAGTAGTGACTGAGTGAAATGATCTAAAGGGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link