fbxl4

Ensembl ID:
ENSDARG00000026941
ZFIN ID:
ZDB-GENE-041114-187
Description:
F-box/LRR-repeat protein 4 [Source:RefSeq peptide;Acc:NP_001007316]
Human Orthologue:
FBXL4
Human Description:
F-box and leucine-rich repeat protein 4 [Source:HGNC Symbol;Acc:13601]
Mouse Orthologue:
Fbxl4
Mouse Description:
F-box and leucine-rich repeat protein 4 Gene [Source:MGI Symbol;Acc:MGI:2140367]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12470 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12470
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004505 Nonsense 271 607 3 8
ENSDART00000137936 Nonsense 280 616 3 8
Genomic Location:
Chromosome 16 (position 34890682)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAGAACAGGCAGAGTCTGGCCAACGGATACTTTGACAGACTCCCTTA[T/A]GAGGTAAGCAGTGRAAACTCTTTACTCAGCWGATKTACRGTTTTGAATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hbg8f6bm