si:ch211-284o19.6

Ensembl ID:
ENSDARG00000026904
ZFIN ID:
ZDB-GENE-070912-288
Description:
hypothetical protein LOC100144567 [Source:RefSeq peptide;Acc:NP_001116533]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19823 Essential Splice Site Available for shipment Available now
sa595 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa19823
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036318 Essential Splice Site 121 212 None 4
ENSDART00000127679   119 139 3 3

The following transcripts of ENSDARG00000026904 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37616101)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37895233
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAAAAAAATCTTTGCTAATGCTGGAAATGCTTATGACTCCAGCACTGG[T/A]AACCTGAGTCATTCATTTCTCTTTATGGCATTAACTGTTATGCCAAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa595
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036318 Nonsense 134 212 4 4
ENSDART00000127679   None 139 3 3

The following transcripts of ENSDARG00000026904 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37616247)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37895379
KASP Assay ID:
554-0505.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGTCTTGCAGGTATTTTCACAGCACCAGTGAATGGGGTCTATTTCTTC[A/T]GATTTTATGCTCATGCTCATCCTACTAAACAAATGGCTGTCAGCCTCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link