ENSDARG00000026900

Ensembl ID:
ENSDARG00000026900
Human Orthologues:
AC012414.2, AC026719.1, AC110285.1, BX072566.1

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37389 Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37389
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000116106 Splice Site None 90 None 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 44370243)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45578197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTATACAGACAGTGCCACACACACACACACACACACACACGGAGACTC[A/G]CGTCGAGCGCGGTGTCCTCATCATCAGAGTCGTGCAGGCCGAGCGCCGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link