ccdc75

Ensembl ID:
ENSDARG00000026892
ZFIN ID:
ZDB-GENE-040718-89
Description:
Coiled-coil domain-containing protein 75 [Source:UniProtKB/Swiss-Prot;Acc:Q6DGZ0]
Human Orthologue:
CCDC75
Human Description:
coiled-coil domain containing 75 [Source:HGNC Symbol;Acc:26768]
Mouse Orthologue:
Ccdc75
Mouse Description:
coiled-coil domain containing 75 Gene [Source:MGI Symbol;Acc:MGI:1858435]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28210 Essential Splice Site Mutation detected in F1 DNA During 2015
sa10202 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa28210
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034541 Essential Splice Site 107 262 3 8
Genomic Location:
Chromosome 13 (position 51220182)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCAGGTGCTGGACGGGTCGAGCCGGTTCCTCTCAACATCAAAACAGG[T/G]CAGGAATATTCTGATTTTCGCATTATTAGTTATTTATGACATTGAGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10202
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034541 Nonsense 252 262 8 8
Genomic Location:
Chromosome 13 (position 51212129)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACTGACATTTTCYCATTCAACAGATGAAGAGGATTTGGGTACRAATTG[T/A]CCTGGAGACACGGCAGCGGATCATGATGATWRAAACAACACAAATGCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ifqdpws2