ccdc75

Ensembl ID:
ENSDARG00000026892
ZFIN ID:
ZDB-GENE-040718-89
Description:
Coiled-coil domain-containing protein 75 [Source:UniProtKB/Swiss-Prot;Acc:Q6DGZ0]
Human Orthologue:
CCDC75
Human Description:
coiled-coil domain containing 75 [Source:HGNC Symbol;Acc:26768]
Mouse Orthologue:
Ccdc75
Mouse Description:
coiled-coil domain containing 75 Gene [Source:MGI Symbol;Acc:MGI:1858435]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42309 Essential Splice Site Mutation detected in F1 DNA During 2016
sa28210 Essential Splice Site Mutation detected in F1 DNA During 2016
sa10202 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42309
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034541 Essential Splice Site 17 262 1 8
Genomic Location (Zv9):
Chromosome 13 (position 51223159)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49934256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTGATGATGAAGATGATTACATGTCTGACGCTTTCCTCAACCAAATG[T/C]GAGTTTAAGAATTGACGTTTTTAGCGTCATACTTGTACAGTCAGAGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28210
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034541 Essential Splice Site 107 262 3 8
Genomic Location (Zv9):
Chromosome 13 (position 51220182)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49931279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCAGGTGCTGGACGGGTCGAGCCGGTTCCTCTCAACATCAAAACAGG[T/G]CAGGAATATTCTGATTTTCGCATTATTAGTTATTTATGACATTGAGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10202
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034541 Nonsense 252 262 8 8
Genomic Location (Zv9):
Chromosome 13 (position 51212129)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49923226
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACTGACATTTTCYCATTCAACAGATGAAGAGGATTTGGGTACRAATTG[T/A]CCTGGAGACACGGCAGCGGATCATGATGATWRAAACAACACAAATGCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link