fam107b

Ensembl ID:
ENSDARG00000026865
ZFIN ID:
ZDB-GENE-031030-12
Description:
hypothetical protein LOC386641 [Source:RefSeq peptide;Acc:NP_938186]
Human Orthologue:
FAM107B
Human Description:
family with sequence similarity 107, member B [Source:HGNC Symbol;Acc:23726]
Mouse Orthologue:
Fam107b
Mouse Description:
family with sequence similarity 107, member B Gene [Source:MGI Symbol;Acc:MGI:1913790]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18229 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18229
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033248 None None 165 None 4
ENSDART00000114024 Essential Splice Site None 134 1 4
ENSDART00000136992 None None 48 None 3
Genomic Location:
Chromosome 18 (position 11775854)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGAARTCACTTGCCTCAGAGAAGTATCKCTCAGGACGGATTTCGAGG[T/C]ATGTGTGTGCTTGACTGTGGGTCTGTTTTCAGGACGCTTTGCATCGAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j96pt7dw