si:ch211-226m16.3

Ensembl ID:
ENSDARG00000026864
ZFIN ID:
ZDB-GENE-040724-8
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q6ZM26]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11101 Nonsense Available for shipment Available now
sa12268 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11101
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030368 Nonsense 64 234 2 4

The following transcripts of ENSDARG00000026864 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 33513438)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 33373236
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTNNGTGTGYGCATRTGTGTATCAGACCWKCARCCCCCCTGTCATT[C/A]AGCACTAAAGGACTGGCTTCAGATTCACGGTGAGYAGATATACTATGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12268
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030368 Nonsense 76 234 2 4

The following transcripts of ENSDARG00000026864 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 33513473)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 33373271
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARCCCCCCTGTCATTMAGCACTAAAGGACTGGCTTCAGATTCACGGTGAG[C/T]AGATATWCTATGACAGGCTGTCTCGAGCACTTCAACAGATCGGCAGGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link