cacna2d4a

Ensembl ID:
ENSDARG00000026855
ZFIN ID:
ZDB-GENE-041210-213
Description:
Novel protein similar to vertebrate calcium channel, voltage-dependent, alpha 2/delta 3 subunit (CAC
Human Orthologue:
CACNA2D4
Human Description:
calcium channel, voltage-dependent, alpha 2/delta subunit 4 [Source:HGNC Symbol;Acc:20202]
Mouse Orthologue:
Cacna2d4
Mouse Description:
calcium channel, voltage-dependent, alpha 2/delta subunit 4 Gene [Source:MGI Symbol;Acc:MGI:2442632]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15879 Essential Splice Site Available for shipment Available now
sa3501 Nonsense Mutation detected in F1 DNA During 2014
sa20268 Essential Splice Site Available for shipment Available now
sa25278 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15879
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048023 Essential Splice Site 193 1091 6 39
ENSDART00000136069 Essential Splice Site 142 743 4 24
Genomic Location:
Chromosome 4 (position 19225939)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATACGCAGCAAAGCGWCGTACAAGTGCCCACAAATGTTTATAAYAAAGG[T/C]ACGTGCCATAAGTGATATTTTACCCCTTAATTAGGAACTGAACATAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3501
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048023 Nonsense 596 1091 19 39
ENSDART00000136069 Nonsense 540 743 17 24
Genomic Location:
Chromosome 4 (position 19209079)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGAACGGCGATGGTAAAAGGGGAAACTGGGACAATCTCTCTGGACGTC[A/T]GAGCAACAGTAGAAAAAGGAGTRAGTTGWATTTGACCTTTAATTTGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20268
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048023 Essential Splice Site 882 1091 30 39
ENSDART00000136069 None None 743 None 24
Genomic Location:
Chromosome 4 (position 19181674)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCATTGACAGTAATGGCTTCATCATCATCTCTAGGGACAAGGCTGATG[T/C]AAGAGCACTTAAAGTGACAGGTTAAGGCCAAATTAAAATGACATTCGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25278
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048023 Nonsense 1061 1091 38 39
ENSDART00000136069 None None 743 None 24
Genomic Location:
Chromosome 4 (position 19174285)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTTCGTTTTTTACTTAACCGCTCAGCACACAATGCCTCAGTGAAATG[T/A]GACCGCATGAGATCTCAGAAGATACGAAGAAGGCCTGAGTCTTGTCACGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3sq9xbaa