cacna2d4a

Ensembl ID:
ENSDARG00000026855
ZFIN ID:
ZDB-GENE-041210-213
Description:
Novel protein similar to vertebrate calcium channel, voltage-dependent, alpha 2/delta 3 subunit (CAC
Human Orthologue:
CACNA2D4
Human Description:
calcium channel, voltage-dependent, alpha 2/delta subunit 4 [Source:HGNC Symbol;Acc:20202]
Mouse Orthologue:
Cacna2d4
Mouse Description:
calcium channel, voltage-dependent, alpha 2/delta subunit 4 Gene [Source:MGI Symbol;Acc:MGI:2442632]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15879 Essential Splice Site Available for shipment Available now
sa33461 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31396 Nonsense Mutation detected in F1 DNA During 2016
sa40286 Nonsense Mutation detected in F1 DNA During 2016
sa33460 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2016
sa20268 Essential Splice Site Available for shipment Available now
sa25278 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15879
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048023 Essential Splice Site 193 1091 6 39
ENSDART00000136069 Essential Splice Site 142 743 4 24
Genomic Location (Zv9):
Chromosome 4 (position 19225939)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20569274
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATACGCAGCAAAGCGWCGTACAAGTGCCCACAAATGTTTATAAYAAAGG[T/C]ACGTGCCATAAGTGATATTTTACCCCTTAATTAGGAACTGAACATAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33461
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048023 Essential Splice Site 472 1091 15 39
ENSDART00000136069   None 743 None 24
Genomic Location (Zv9):
Chromosome 4 (position 19212072)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20555407
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATTTGTTGATTTTTCGATGTCTGTCTCTTCCTCTCTCTCGTCTTTCA[G/A]CTTTTTAACACACAGGCCGAGAGTTTGCTGTTGATGACCTCTGTAGCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31396
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048023 Nonsense 522 1091 16 39
ENSDART00000136069 Nonsense 466 743 14 24
Genomic Location (Zv9):
Chromosome 4 (position 19210062)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20553397
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGGTTGGCACTGATGTTCCCTTGAAGGAGCTCATGAGATTGGCTCCT[C/T]GATACAAGGTGCCTTAATAATATCATCAGTTCTCTGTTGATCACATCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40286
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048023 Nonsense 689 1091 23 39
ENSDART00000136069 Nonsense 633 743 21 24
Genomic Location (Zv9):
Chromosome 4 (position 19208437)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20551772
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGCAAATTGACGCAGCTTCAGGCCGTGGTTCGGTATTTAACAGGAAAA[G/T]AACCAGATCTGGAATGTGAGTTCTGTTTTTAGAAACTTGCACATTCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33460
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048023 Essential Splice Site 725 1091 25 39
ENSDART00000136069 Splice Site None 743 None 24
Genomic Location (Zv9):
Chromosome 4 (position 19207915)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20551250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCATTAGTGAAATACGTGCTCGGCCGTGACCTTTCTCATTCTTTTGCA[T/A]GCAGTATTGATGGGGGAGTGGAGACAGCGTTCCTGGGCACGCGCTCTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20268
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048023 Essential Splice Site 882 1091 30 39
ENSDART00000136069   None 743 None 24
Genomic Location (Zv9):
Chromosome 4 (position 19181674)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20525009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCATTGACAGTAATGGCTTCATCATCATCTCTAGGGACAAGGCTGATG[T/C]AAGAGCACTTAAAGTGACAGGTTAAGGCCAAATTAAAATGACATTCGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25278
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048023 Nonsense 1061 1091 38 39
ENSDART00000136069   None 743 None 24
Genomic Location (Zv9):
Chromosome 4 (position 19174285)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20517620
KASP Assay ID:
554-7670.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTTCGTTTTTTACTTAACCGCTCAGCACACAATGCCTCAGTGAAATG[T/A]GACCGCATGAGATCTCAGAAGATACGAAGAAGGCCTGAGTCTTGTCACGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link