acin1b

Ensembl ID:
ENSDARG00000026842
ZFIN ID:
ZDB-GENE-030826-12
Human Orthologue:
ACIN1
Human Description:
apoptotic chromatin condensation inducer 1 [Source:HGNC Symbol;Acc:17066]
Mouse Orthologue:
Acin1
Mouse Description:
apoptotic chromatin condensation inducer 1 Gene [Source:MGI Symbol;Acc:MGI:1891824]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9490 Nonsense Available for shipment Available now
sa13260 Nonsense Available for shipment Available now
sa18154 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9490
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034218 Nonsense 332 1259 5 17
ENSDART00000141749 None None 604 None 11
Genomic Location:
Chromosome 7 (position 25242818)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGTCAGCCCACTCCTCCACCATCTCCACCTCCAGAGCTCTCATTCCCAT[T/G]ACCTGATACTCCCAAACAGAGTCCACATGACCAAGATGAGCCAGCRGGYC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13260
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034218 Nonsense 899 1259 12 17
ENSDART00000141749 Nonsense 244 604 6 11
Genomic Location:
Chromosome 7 (position 25258355)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCAGTCAGCAGAAGTCAGGTGTGWCCATCACTRTCGATGACCCCATA[C/T]GAACGGGCCGCCAGCTTTCTCCTCCTCGTGGAAAAACCTCCAACATCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18154
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034218 Nonsense 1199 1259 17 17
ENSDART00000141749 Nonsense 544 604 11 11
Genomic Location:
Chromosome 7 (position 25262571)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCAAAAGGCCGCGACCGAGTGGGAGGAAAYACAGCAGAAACCAGAGCT[G/T]KAGTTCCCAGACGGTCAACCGAAGGGGAGAGAGASCGAGGGAAGGGCGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ucll66nt