acin1b

Ensembl ID:
ENSDARG00000026842
ZFIN ID:
ZDB-GENE-030826-12
Human Orthologue:
ACIN1
Human Description:
apoptotic chromatin condensation inducer 1 [Source:HGNC Symbol;Acc:17066]
Mouse Orthologue:
Acin1
Mouse Description:
apoptotic chromatin condensation inducer 1 Gene [Source:MGI Symbol;Acc:MGI:1891824]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9490 Nonsense Available for shipment Available now
sa38607 Nonsense Mutation detected in F1 DNA During 2016
sa40879 Nonsense Mutation detected in F1 DNA During 2016
sa13260 Nonsense Available for shipment Available now
sa40880 Nonsense Mutation detected in F1 DNA During 2016
sa18154 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9490
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034218 Nonsense 332 1259 5 17
ENSDART00000141749   None 604 None 11
Genomic Location (Zv9):
Chromosome 7 (position 25242818)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23804570
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGTCAGCCCACTCCTCCACCATCTCCACCTCCAGAGCTCTCATTCCCAT[T/G]ACCTGATACTCCCAAACAGAGTCCACATGACCAAGATGAGCCAGCRGGYC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38607
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034218 Nonsense 644 1259 6 17
ENSDART00000141749   None 604 None 11
Genomic Location (Zv9):
Chromosome 7 (position 25244026)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23805778
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGAAGTTGTCCTTTCTTTACTCAAACCAGGATGTAGAAGAGAAAGGA[C/T]GAAAAGGTGCTGAAGAAAAGAAGGCTCAGTCTTCAAGGTTAGCAAATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40879
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034218 Nonsense 793 1259 10 17
ENSDART00000141749 Nonsense 138 604 4 11
Genomic Location (Zv9):
Chromosome 7 (position 25257883)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23819635
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCAGATGAGGGCCGTCTCTCTGTGGATGAGGACTCCTCTGGCCCTCGT[G/T]AACGAGAGGAACCGGAAGAGGATCAGGGCCTGAAAATCAGACGCACAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13260
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034218 Nonsense 899 1259 12 17
ENSDART00000141749 Nonsense 244 604 6 11
Genomic Location (Zv9):
Chromosome 7 (position 25258355)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23820107
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCAGTCAGCAGAAGTCAGGTGTGWCCATCACTRTCGATGACCCCATA[C/T]GAACGGGCCGCCAGCTTTCTCCTCCTCGTGGAAAAACCTCCAACATCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40880
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034218 Nonsense 1175 1259 17 17
ENSDART00000141749 Nonsense 520 604 11 11
Genomic Location (Zv9):
Chromosome 7 (position 25262499)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23824251
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGCGAGAGAAGAGGAGGAAGGAAATCTTTGAGGAAGAAGACAAAAAA[C/T]GAAAAGAAAGAGAGCAAGAGAGAGCAAAAGGCCGCGACCGAGTGGGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18154
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034218 Nonsense 1199 1259 17 17
ENSDART00000141749 Nonsense 544 604 11 11
Genomic Location (Zv9):
Chromosome 7 (position 25262571)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23824323
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCAAAAGGCCGCGACCGAGTGGGAGGAAAYACAGCAGAAACCAGAGCT[G/T]KAGTTCCCAGACGGTCAACCGAAGGGGAGAGAGASCGAGGGAAGGGCGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link