cotl1

Ensembl ID:
ENSDARG00000026829
ZFIN ID:
ZDB-GENE-030131-8325
Description:
coactosin-like protein [Source:RefSeq peptide;Acc:NP_956306]
Human Orthologue:
COTL1
Human Description:
coactosin-like 1 (Dictyostelium) [Source:HGNC Symbol;Acc:18304]
Mouse Orthologue:
Cotl1
Mouse Description:
coactosin-like 1 (Dictyostelium) Gene [Source:MGI Symbol;Acc:MGI:1919292]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39194 Nonsense Mutation detected in F1 DNA During 2017
sa43066 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39194
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032151 Nonsense 4 142 1 4
Genomic Location (Zv9):
Chromosome 18 (position 12680773)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 13235585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTGCATTTAGACACATTATCTCCCTTTGCATCGTCGAAATGGCAACA[C/T]GAATTGACAAAGAGGCTTGCAGAGAGGCATACAATCTGGTGCGAGACGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43066
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032151 Nonsense 137 142 4 4
Genomic Location (Zv9):
Chromosome 18 (position 12692618)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 13247430
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAAGAATACCTACGTACTGAGCTCAAGAAAGCTGGCGGCGCCAACTA[T/A]GATGCCCAGGCTGAATAAAACTTGGGGATGGGTTTCCACTGGGTTGAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link