gc3

Ensembl ID:
ENSDARG00000026820
ZFIN ID:
ZDB-GENE-011128-9
Description:
Guanylate cyclase [Source:UniProtKB/TrEMBL;Acc:A2BFQ0]
Human Orthologue:
GUCY2D
Human Description:
guanylate cyclase 2D, membrane (retina-specific) [Source:HGNC Symbol;Acc:4689]
Mouse Orthologue:
Gucy2e
Mouse Description:
guanylate cyclase 2e Gene [Source:MGI Symbol;Acc:MGI:105123]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20486 Nonsense Mutation detected in F1 DNA During 2014
sa16059 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20486
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097765 None None 331 3 18
ENSDART00000097770 Nonsense 465 1138 3 18
ENSDART00000130295 None None 289 None 7
ENSDART00000145907 Nonsense 465 1176 4 20
Genomic Location:
Chromosome 5 (position 39752305)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCCTGGAAGCTTCACACACATATGGAAAATATGGAGGGTTAAAATACT[T/A]GGGGAAGTCAATTCATTTTGCTGGAGCGTCTCCGAGCAGTGACGCGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16059
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097765 None None 331 None 18
ENSDART00000097770 Essential Splice Site 839 1138 11 18
ENSDART00000130295 None None 289 None 7
ENSDART00000145907 Essential Splice Site 877 1176 12 20
Genomic Location:
Chromosome 5 (position 39745883)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTGAGGAGCCTGAACAGAGGCCTACRTTTGAGGATATATTCAGACAGG[T/C]ACACACTAAYTCTTTCATTNGCGCACACACACAAACAAGACACTTAMAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2si676a0