extl3

Ensembl ID:
ENSDARG00000026811
ZFIN ID:
ZDB-GENE-041124-2
Description:
exostosin-like 3 [Source:RefSeq peptide;Acc:NP_001008402]
Human Orthologue:
EXTL3
Human Description:
exostoses (multiple)-like 3 [Source:HGNC Symbol;Acc:3518]
Mouse Orthologue:
Extl3
Mouse Description:
exostoses (multiple)-like 3 Gene [Source:MGI Symbol;Acc:MGI:1860765]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17419 Nonsense Available for shipment Available now
sa23818 Essential Splice Site Available for shipment Available now
sa43541 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17419
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039499 Nonsense 398 917 1 5
Genomic Location (Zv9):
Chromosome 20 (position 50272572)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 50157515
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGCTGTACAGGACAGTCACCTAGACCAGRTTCTTGTGGAGTTTACTTG[C/A]AAGAATCAAGCCAAGCCAAGTTTACCAACAGAGTGGGCATTGTGTGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23818
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039499 Essential Splice Site 805 917 3 5
Genomic Location (Zv9):
Chromosome 20 (position 50265042)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 50149985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTGCGAGCTCTCCATGGTGCTGACGGGTGCGGCCTTCTTCCACAAGG[T/C]GAAACTGTGACCGCTTTCACACTTCCAGAGCACGATTATGTCAAAAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43541
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039499 Nonsense 857 917 5 5
Genomic Location (Zv9):
Chromosome 20 (position 50253265)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 50138208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTCTGGCGTATCCCCTCTCAGGTGACGTCCCGTTGGACCTTCCGCTG[T/A]CCCGGCTGCCCACAGGCTCTATCGCATGACGATTCGCACTTCCACGAGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link