extl3

Ensembl ID:
ENSDARG00000026811
ZFIN ID:
ZDB-GENE-041124-2
Description:
exostosin-like 3 [Source:RefSeq peptide;Acc:NP_001008402]
Human Orthologue:
EXTL3
Human Description:
exostoses (multiple)-like 3 [Source:HGNC Symbol;Acc:3518]
Mouse Orthologue:
Extl3
Mouse Description:
exostoses (multiple)-like 3 Gene [Source:MGI Symbol;Acc:MGI:1860765]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17419 Nonsense Available for shipment Available now
sa23818 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17419
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039499 Nonsense 398 917 1 5
Genomic Location:
Chromosome 20 (position 50272572)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGCTGTACAGGACAGTCACCTAGACCAGRTTCTTGTGGAGTTTACTTG[C/A]AAGAATCAAGCCAAGCCAAGTTTACCAACAGAGTGGGCATTGTGTGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23818
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039499 Essential Splice Site 805 917 3 5
Genomic Location:
Chromosome 20 (position 50265042)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTGCGAGCTCTCCATGGTGCTGACGGGTGCGGCCTTCTTCCACAAGG[T/C]GAAACTGTGACCGCTTTCACACTTCCAGAGCACGATTATGTCAAAAATAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/aqvgxusl