robo1

Ensembl ID:
ENSDARG00000026784
ZFIN IDs:
ZDB-GENE-000209-3, ZDB-GENE-000209-3
Description:
roundabout homolog 1 [Source:RefSeq peptide;Acc:NP_571556]
Human Orthologue:
ROBO1
Human Description:
roundabout, axon guidance receptor, homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:10249]
Mouse Orthologue:
Robo1
Mouse Description:
roundabout homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1274781]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18311 Nonsense Available for shipment Available now
sa12940 Nonsense Available for shipment Available now
sa8915 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13462 Nonsense Available for shipment Available now
sa13877 Nonsense Available for shipment Available now
sa11384 Nonsense Available for shipment Available now
sa22712 Nonsense Mutation detected in F1 DNA During 2014
sa7411 Missense Mutation detected in F1 DNA During 2014
sa3911 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16335 Essential Splice Site, Splice Site Available for shipment Available now
sa2786 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa18311
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034683 Nonsense 33 1568 1 29
ENSDART00000076098 Nonsense 33 1591 1 33
ENSDART00000097133 Nonsense 96 1632 1 28
ENSDART00000097134 None None 1533 None 29
ENSDART00000126856 Nonsense 33 839 1 20
Genomic Location:
Chromosome 15 (position 37505204)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCGCAGCAAACCCGACGAAGGCTCCTAYGTTTGTGTGGCACGTARCTA[T/A]CTGGGAGAAGCCGTCAGCCAYAACGCCTMGCTGGAAGTAGCTAGTAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12940
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034683 Nonsense 76 1568 2 29
ENSDART00000076098 Nonsense 76 1591 2 33
ENSDART00000097133 Nonsense 139 1632 2 28
ENSDART00000097134 Nonsense 39 1533 2 29
ENSDART00000126856 Nonsense 76 839 2 20
Genomic Location:
Chromosome 15 (position 37680004)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTGATGGTGGCAGCGGGGGAGCCAGCYGTMATGGAGTGCCAGCCGCCC[C/T]GAGGACACCCAGAGCCCACCATCTCCTGGAAGAAAGATGGGGTCAATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8915
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034683 Essential Splice Site 140 1568 3 29
ENSDART00000076098 Essential Splice Site 140 1591 3 33
ENSDART00000097133 Essential Splice Site 203 1632 3 28
ENSDART00000097134 Essential Splice Site 103 1533 3 29
ENSDART00000126856 Essential Splice Site 140 839 3 20
Genomic Location:
Chromosome 15 (position 37694763)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACATGATGGGGGAACGAGAGAGCGAGATYGCGGAGTTGACTGTTCTCG[G/A]TAGGTTTTCAGTGCATTTCTGTTTTCATTTATGCGTTCCAGTGCATCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13462
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034683 Nonsense 587 1568 14 29
ENSDART00000076098 Nonsense 584 1591 13 33
ENSDART00000097133 Nonsense 651 1632 13 28
ENSDART00000097134 Nonsense 552 1533 14 29
ENSDART00000126856 Nonsense 587 839 14 20
Genomic Location:
Chromosome 15 (position 37730290)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGTGTTTTTGTCCTGTTGTTGTGTTCAGGYGGAGCAGCAGTCTCAGTA[T/A]ATWCAGGGCTAKAAGGTGATGTACCGTCCSTCTCCAGAAGGCGCTCCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13877
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034683 Nonsense 591 1568 14 29
ENSDART00000076098 Nonsense 588 1591 13 33
ENSDART00000097133 Nonsense 655 1632 13 28
ENSDART00000097134 Nonsense 556 1533 14 29
ENSDART00000126856 Nonsense 591 839 14 20
Genomic Location:
Chromosome 15 (position 37730302)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGTTGTTGTGTTCAGGYGGAGCAGCAGTCTCAGTAWATWCAGGGCTA[T/G]AAGGTGATGTACCGTCCSTCTCCAGAAGGCGCTCCGCAGCGAGYGGATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11384
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034683 Nonsense 632 1568 14 29
ENSDART00000076098 Nonsense 629 1591 13 33
ENSDART00000097133 Nonsense 696 1632 13 28
ENSDART00000097134 Nonsense 597 1533 14 29
ENSDART00000126856 Nonsense 632 839 14 20
Genomic Location:
Chromosome 15 (position 37730425)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGGRGAGCACAGYGCTGTCGTCACCCAGCTCAAGAAGGGCATCACCTA[T/A]GAGTTCAAAGTGCGCCCTTTCTTCAATGAGTTCCAGGGCACCGACAGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22712
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034683 Nonsense 665 1568 15 29
ENSDART00000076098 Nonsense 662 1591 14 33
ENSDART00000097133 Nonsense 729 1632 14 28
ENSDART00000097134 Nonsense 630 1533 15 29
ENSDART00000126856 Nonsense 665 839 15 20
Genomic Location:
Chromosome 15 (position 37735271)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTAGAATTTAATTTGTGTTTTCTTTTCAGCTCCCAGCGCTGCTCCC[A/T]GAGGCGTCACCGTAACAGGAAGTGGAGACAACGGCACAGCAGTCCTGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7411
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034683 Missense 764 1568 17 29
ENSDART00000076098 Missense 761 1591 16 33
ENSDART00000097133 Missense 828 1632 16 28
ENSDART00000097134 Missense 729 1533 17 29
ENSDART00000126856 Missense 764 839 17 20
Genomic Location:
Chromosome 15 (position 37747357)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCATGTTYTCCTTGTGTGTNTTTTTTCAGACTCTTCTGGCCGTGTTCTC[C/A]MGCCGCCRCTGGACGAMGATAACACCATTTCCCAGCAGATMTCAGACGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3911
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034683 Essential Splice Site 848 1568 19 29
ENSDART00000076098 Essential Splice Site 845 1591 18 33
ENSDART00000097133 Essential Splice Site 912 1632 18 28
ENSDART00000097134 Essential Splice Site 813 1533 19 29
ENSDART00000126856 None None 839 None 20
Genomic Location:
Chromosome 15 (position 37758700)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTACAGTGGCCTATCAGAGAGGYGGAGAGGCCGTCAGCAGTGCAGGAAG[G/A]TGAGATCATCTTTAAAAWATATATGCATTCTGTYATTTAGCAYGTTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16335
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034683 Splice Site None 1568 None 29
ENSDART00000076098 Splice Site None 1591 None 33
ENSDART00000097133 Splice Site None 1632 None 28
ENSDART00000097134 Essential Splice Site 864 1533 21 29
ENSDART00000126856 None None 839 None 20
Genomic Location:
Chromosome 15 (position 37765520)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCGTAATCAAGTCCTTTGGCTTCCAAAWTGTCTTACTCCTCTTCTATCA[T/A]CCAGCCGACTGCATYGCCAACTWCAGCAACCAGATGGACAACAAGGCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2786
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034683 Nonsense 1288 1568 25 29
ENSDART00000076098 Nonsense 1311 1591 29 33
ENSDART00000097133 Nonsense 1352 1632 24 28
ENSDART00000097134 Nonsense 1253 1533 25 29
ENSDART00000126856 None None 839 None 20
Genomic Location:
Chromosome 15 (position 37774324)
KASP Assay ID:
554-2510.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGACCTGGAGAGCTCTGTGACYGGGTCTATGATTAACGGATGGGGTT[C/A]GGCTTCAGAAGAGGACAACGCCTCRTCAGGCCRTTCCAGTGCAGTCAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/im0h9odm