bcl2l10

Ensembl ID:
ENSDARG00000026766
ZFIN ID:
ZDB-GENE-030825-2
Description:
myeloid cell leukemia sequence 1-like [Source:RefSeq peptide;Acc:NP_919379]
Human Orthologue:
BCL2L10
Human Description:
BCL2-like 10 (apoptosis facilitator) [Source:HGNC Symbol;Acc:993]
Mouse Orthologue:
Bcl2l10
Mouse Description:
Bcl2-like 10 Gene [Source:MGI Symbol;Acc:MGI:1330841]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36704 Nonsense Available for shipment Available now
sa23356 Nonsense Available for shipment Available now
sa23357 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36704
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030838 Nonsense 35 203 2 3
ENSDART00000122377 Nonsense 8 176 2 3
Genomic Location (Zv9):
Chromosome 18 (position 37546031)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 39127734
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAACAAATATTGTGAATTCATTTAGAAAATGTCCTGTTGGTTGAGGGAA[C/T]AGACTCTGTTGCTGGCGGAGGACTACATCAGCTTCTGCAGTGGGATCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23356
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030838 Nonsense 89 203 2 3
ENSDART00000122377 Nonsense 62 176 2 3
Genomic Location (Zv9):
Chromosome 18 (position 37546193)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 39127896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACAGAACCAAATTCCGATCCCTTTCCCAGGAGTTCCTGGACACCTGC[G/T]GAGCAGATCCCAGCAAATGTCTGCAGAGCGTCATGAGAGAACTGGTGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23357
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030838 Nonsense 95 203 2 3
ENSDART00000122377 Nonsense 68 176 2 3
Genomic Location (Zv9):
Chromosome 18 (position 37546213)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 39127916
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCTTTCCCAGGAGTTCCTGGACACCTGCGGAGCAGATCCCAGCAAATG[T/A]CTGCAGAGCGTCATGAGAGAACTGGTGGGAGATGGGAAAATGAACTGGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link