ahsg

Ensembl ID:
ENSDARG00000026764
ZFIN IDs:
ZDB-GENE-041114-50, ZDB-GENE-041114-50
Description:
alpha-2-HS-glycoprotein [Source:RefSeq peptide;Acc:NP_997787]
Human Orthologue:
AHSG
Human Description:
alpha-2-HS-glycoprotein [Source:HGNC Symbol;Acc:349]
Mouse Orthologue:
Ahsg
Mouse Description:
alpha-2-HS-glycoprotein Gene [Source:MGI Symbol;Acc:MGI:107189]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24221 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24221
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028565 Nonsense 170 455 4 7
ENSDART00000127493 Nonsense 170 450 4 8
Genomic Location:
Chromosome 22 (position 40836618)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCAAGGCTCTGGAGAGTGTGAACGCTGCCCTGGCCAAGTTCAACAAA[C/T]AGTCCAACCACAAGTCTTACTTTAAGCTGATGGAAGTGGGAAGGATCAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Prothrombin time: Genetic associations for activated partial thromboplastin time and prothrombin time, their gene expression profiles, and risk of coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3jxbaes5