ap1m2

Ensembl ID:
ENSDARG00000026759
ZFIN IDs:
ZDB-GENE-040426-1254, ZDB-GENE-041114-20
Description:
AP-1 complex subunit mu-2 [Source:RefSeq peptide;Acc:NP_991277]
Human Orthologue:
AP1M2
Human Description:
adaptor-related protein complex 1, mu 2 subunit [Source:HGNC Symbol;Acc:558]
Mouse Orthologue:
Ap1m2
Mouse Description:
adaptor protein complex AP-1, mu 2 subunit Gene [Source:MGI Symbol;Acc:MGI:1336974]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20601 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2330 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20601
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034505 Essential Splice Site 133 424 4 12
ENSDART00000062170 None None 281 None 6
ENSDART00000125176 Essential Splice Site 761 1052 17 25
Genomic Location:
Chromosome 6 (position 51069)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGGACTTTGGGTTCCCGCAGACGACGGACAGCAAGATCCTGCAGGAG[T/C]AAGAGCCGCCCCCCTCCACTGGACCCTCAGGTGTGCTCGGGTATGCTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2330
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034505 Essential Splice Site 349 424 9 12
ENSDART00000062170 None None 281 None 6
ENSDART00000125176 Essential Splice Site 977 1052 22 25
Genomic Location:
Chromosome 6 (position 53299)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACGTCCCCGAGAAGAACCTGGTGGTGTGGAGCATCAAATCCTTCCCTG[T/A]AAGCAGAGATTACCGATGGCCAGTGTTTATTTACTTGTCCTCAAGATGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mo5xfet1