rnf168

Ensembl ID:
ENSDARG00000026757
ZFIN ID:
ZDB-GENE-030131-6013
Description:
E3 ubiquitin-protein ligase RNF168 [Source:UniProtKB/Swiss-Prot;Acc:Q7T308]
Human Orthologue:
RNF168
Human Description:
ring finger protein 168 [Source:HGNC Symbol;Acc:26661]
Mouse Orthologue:
Rnf168
Mouse Description:
ring finger protein 168 Gene [Source:MGI Symbol;Acc:MGI:1917488]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39028 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39028
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028481 Essential Splice Site 248 474 6 7
Genomic Location (Zv9):
Chromosome 15 (position 3974014)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3909566
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAAGCAGTTCTGACAGCAGCCCAGACTCCTCCCTGATGGCTAATAAGG[T/C]AATTTATGCATGAATGAAATGAAATTATTACTATTGTAATTAACAGAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link