grik4

Ensembl ID:
ENSDARG00000026753
ZFIN ID:
ZDB-GENE-070821-5
Human Orthologue:
GRIK4
Human Description:
glutamate receptor, ionotropic, kainate 4 [Source:HGNC Symbol;Acc:4582]
Mouse Orthologue:
Grik4
Mouse Description:
glutamate receptor, ionotropic, kainate 4 Gene [Source:MGI Symbol;Acc:MGI:95817]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16435 Essential Splice Site Available for shipment Available now
sa16493 Essential Splice Site Available for shipment Available now
sa13014 Nonsense Available for shipment Available now
sa15276 Nonsense Available for shipment Available now
sa16037 Essential Splice Site Available for shipment Available now
sa24983 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13341 Nonsense Available for shipment Available now
sa10219 Nonsense Available for shipment Available now
sa22637 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16435
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035812 Essential Splice Site 83 965 3 19
ENSDART00000035812 Essential Splice Site 83 965 3 19
Genomic Location:
Chromosome 15 (position 22298668)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTGTGTCTGTAATAAATGACAGTTGGTCTTTCCCTTATCTATTGACA[G/T]TGTGCCAGATCATGTCCAARGGKGTGGTGGCGGTCCTGGGCCCCTCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16493
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035812 Essential Splice Site 83 965 3 19
ENSDART00000035812 Essential Splice Site 83 965 3 19
Genomic Location:
Chromosome 15 (position 22298668)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTGTGTCTGTAATAAATGACAGTTGGTCTTTCCCTTATCTATTGACA[G/T]TGTGCCAGATCATGTCCAARGGKGTGGTGGCGGTCCTGGGCCCCTCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13014
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035812 Nonsense 241 965 6 19
Genomic Location:
Chromosome 15 (position 22360484)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTCATTTGTCWTCCAGGCCTCAGAGTTGGGGATGCTGTCAGTCTACTA[C/A]ACCTACATCCTGACTTCCTTGGTGAGATGCTGTCTAATGCTGGARTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15276
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035812 Nonsense 287 965 7 19
Genomic Location:
Chromosome 15 (position 22408882)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTCAACAGKACACATCCTTTCTTTCAGGACTTTGTGCTCAGCCTCAAT[C/T]GATCCTGGCAGGAGAACTGTGATCACGCACCRTTTGCAGGARCACCGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16037
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035812 Essential Splice Site 353 965 8 19
Genomic Location:
Chromosome 15 (position 22414056)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTAAGATCTGGGARCAYGGCACGAGTCTGATGAACTACCTGAGGATGG[T/G]AARAATCGCGGGGAAGAGCCCACCAGCTGCCAATCATCTCACCTGCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24983
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035812 Essential Splice Site 424 965 10 19
Genomic Location:
Chromosome 15 (position 22460731)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGACGGACACACTATTCAACACCACTCTCACCATAACTACCATTCTGG[T/C]AAGTCCTGTCTTCTACTGCATATTCATGGTCCACATATCCTACCGATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13341
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035812 Nonsense 428 965 11 19
Genomic Location:
Chromosome 15 (position 22485095)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGAGTTAATCTCTGACGCCAGTGCTGTGTTTACAGRAGAACCCGTA[T/A]GTAATGTTGAGAGCCAATCACCAGGAGCTTGAAGGGAACGATCGCTAWGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10219
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035812 Nonsense 444 965 11 19
Genomic Location:
Chromosome 15 (position 22485143)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGTAATGTTGAGAGCCAATCACCAGGAGCTTGAAGGGAACGATCGCTA[T/A]GAGGGCTTCTGTGTGGACATGCTAAAGGAGCTGGCGGACATCTTGAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22637
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035812 Essential Splice Site 567 965 13 19
Genomic Location:
Chromosome 15 (position 22525622)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTGCTGGCGTACCTGGCTGTCAGCTGCGTGCTCTTTTTGGTGGCGAG[G/A]TAAATTCTCAGCTCCACACTGACACCTGCAGGATCTTATTAGCACTGACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/030csonm