il11ra

Ensembl ID:
ENSDARG00000026736
ZFIN ID:
ZDB-GENE-030131-5942
Description:
interleukin 11 receptor, alpha [Source:RefSeq peptide;Acc:NP_001106971]
Human Orthologue:
IL11RA
Human Description:
interleukin 11 receptor, alpha [Source:HGNC Symbol;Acc:5967]
Mouse Orthologues:
Gm13305, Gm2002, Il11ra1, Il11ra2
Mouse Descriptions:
interleukin 11 receptor, alpha chain 1 Gene [Source:MGI Symbol;Acc:MGI:107426]
interleukin 11 receptor, alpha chain 2 Gene [Source:MGI Symbol;Acc:MGI:109123]
predicted gene 13305 Gene [Source:MGI Symbol;Acc:MGI:3801997]
predicted gene 2002 Gene [Source:MGI Symbol;Acc:MGI:3780172]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12313 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12313
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030976 Nonsense 161 402 5 10
ENSDART00000135941 Nonsense 161 402 5 11
Genomic Location:
Chromosome 10 (position 13294272)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATACAGTCAGAAGGGCCAGGGCCGCAAGCAAATTCCCAGTGAACCCTG[T/A]GAACAGAAGGATWCCGGGGTAAATGAGTGYACAATTAMAGACCCACCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yl6nynfs