ENSDARG00000026663

Ensembl ID:
ENSDARG00000026663
Mouse Orthologues:
Tlr11, Tlr12
Mouse Descriptions:
toll-like receptor 11 Gene [Source:MGI Symbol;Acc:MGI:3045226]
toll-like receptor 12 Gene [Source:MGI Symbol;Acc:MGI:3045221]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22826 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22826
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036422 None None 103 None 2
ENSDART00000132944 Nonsense 157 851 1 3
Genomic Location:
Chromosome 16 (position 24908945)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTGGGGTTCAAAATCTGTATTTAATTGGGAACAATATTAAATATATT[C/T]AAGCAAACTCCTTAATTATATTCCAGAACCTCTCAAGCCTTTTTCTGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/otfq7ow7