ENSDARG00000026663

Ensembl ID:
ENSDARG00000026663
Mouse Orthologues:
Tlr11, Tlr12
Mouse Descriptions:
toll-like receptor 11 Gene [Source:MGI Symbol;Acc:MGI:3045226]
toll-like receptor 12 Gene [Source:MGI Symbol;Acc:MGI:3045221]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22826 Nonsense Mutation detected in F1 DNA During 2016
sa42711 Nonsense Mutation detected in F1 DNA During 2016
sa28651 Nonsense Mutation detected in F1 DNA During 2016
sa39098 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22826
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036422   None 103 None 2
ENSDART00000132944 Nonsense 157 851 1 3
Genomic Location (Zv9):
Chromosome 16 (position 24908945)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22813261
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTGGGGTTCAAAATCTGTATTTAATTGGGAACAATATTAAATATATT[C/T]AAGCAAACTCCTTAATTATATTCCAGAACCTCTCAAGCCTTTTTCTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42711
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036422   None 103 None 2
ENSDART00000132944 Nonsense 419 851 1 3
Genomic Location (Zv9):
Chromosome 16 (position 24908159)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22812475
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGTTGCATCTAGAGAACATTTTTTTTGAATTTCCACCAAAGTTACAG[C/T]GACTCAGCATCGATGCACATTATGGAACTAATATTTACATTGGAAACGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28651
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036422 Nonsense 77 103 2 2
ENSDART00000132944 Nonsense 781 851 2 3
Genomic Location (Zv9):
Chromosome 16 (position 24905138)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22809454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAGCATCCACAACAGTCAGTGCACTGTTTGTCTGATCAGCCGGCGGTA[T/A]CTGCGCAGTGACTGGTGTGGTCTGGAGATGCGAGTGGCCACACACCGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39098
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036422   None 103 None 2
ENSDART00000132944 Nonsense 848 851 3 3
Genomic Location (Zv9):
Chromosome 16 (position 24902654)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22806970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTACATATCTGGACTGGCCAGAGGAAGAAGGAGACCGAGAGCACTTCTG[G/A]GATCGACTAAGGAGGAACATTGCAGAAGATTCTGTAAGTACAAAAACATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link