asb1

Ensembl ID:
ENSDARG00000026635
ZFIN ID:
ZDB-GENE-040718-234
Description:
ankyrin repeat and SOCS box protein 1 [Source:RefSeq peptide;Acc:NP_001002736]
Human Orthologue:
ASB1
Human Description:
ankyrin repeat and SOCS box-containing 1 [Source:HGNC Symbol;Acc:16011]
Mouse Orthologue:
Asb1
Mouse Description:
ankyrin repeat and SOCS box-containing 1 Gene [Source:MGI Symbol;Acc:MGI:1929735]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18966 Nonsense Mutation detected in F1 DNA During 2014
sa3736 Nonsense Mutation detected in F1 DNA During 2014
sa5786 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18966
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036369 Nonsense 283 335 4 5
ENSDART00000036369 Nonsense 283 335 4 5
ENSDART00000036369 Nonsense 283 335 4 5
Genomic Location:
Chromosome 9 (position 46762151)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGGACGAGCTCGACCCTGACACAATGATTCGGTTAAAGGTCAACGTC[G/T]AAGCCCTCTGTGTCTACCAGGAGGCCAGAAGTAAGTTGTCTTGGCATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3736
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036369 Nonsense 283 335 4 5
ENSDART00000036369 Nonsense 283 335 4 5
ENSDART00000036369 Nonsense 283 335 4 5
Genomic Location:
Chromosome 9 (position 46762151)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGGGACGAGCTCGACCCTGACACAATGATTCGGTTAAAGGTCAACGTC[G/T]AAGCCCTCTGTGTCTACCAGGAGGCCAGAAGTAAGTTGTCTTGGCATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5786
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036369 Nonsense 283 335 4 5
ENSDART00000036369 Nonsense 283 335 4 5
ENSDART00000036369 Nonsense 283 335 4 5
Genomic Location:
Chromosome 9 (position 46762151)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGGGACGAGCTCGACCCTGACACAATGATTCGGTTAAAGGTCAACGTC[G/T]AAGCCCTCTGTGTCTACCAGGAGGCCAGAAGTAAGTTGTCTTGGCATTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hmdrw2mp