ehmt1b

Ensembl ID:
ENSDARG00000026634
ZFIN ID:
ZDB-GENE-080515-3
Description:
euchromatic histone-lysine N-methyltransferase 1b [Source:RefSeq peptide;Acc:NP_001166035]
Human Orthologue:
EHMT1
Human Description:
euchromatic histone-lysine N-methyltransferase 1 [Source:HGNC Symbol;Acc:24650]
Mouse Orthologue:
Ehmt1
Mouse Description:
euchromatic histone methyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1924933]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37259 Nonsense Mutation detected in F1 DNA During 2016
sa43607 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17604 Essential Splice Site Available for shipment Available now
sa43606 Nonsense Mutation detected in F1 DNA During 2016
sa13273 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37259
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123047 Nonsense 339 1286 6 27
ENSDART00000124223 Nonsense 58 1005 2 23

The following transcripts of ENSDARG00000026634 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12866016)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14567190
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGAATGGAGAGAAAATGGATAATGAGTCTGATGAGGAGGAGTCAGAG[G/T]AAGGGGAAGACACAGAGGATGAAGAAGAGCTAGTCACAGAAGATGGAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43607
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123047 Essential Splice Site 393 1286 8 27
ENSDART00000124223 Essential Splice Site 112 1005 4 23

The following transcripts of ENSDARG00000026634 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12865579)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14566753
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCTGTATTGCTCCATTTGTTGACTGTGACTTATGTCTATCCTCTTCA[G/T]AGTTCAGAATCCAGTTTGAAAAAGAAATGGAAAAAGAAAGCCAAAGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17604
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123047 Essential Splice Site 432 1286 8 27
ENSDART00000124223 Essential Splice Site 151 1005 4 23

The following transcripts of ENSDARG00000026634 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12865459)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14566633
KASP Assay ID:
2261-5393.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAGGAAACGCAAGAGGAAATGGAAAGCAAAAACGGACAAGGTTTCTGG[T/A]GAGAGTTTAAATGCATGTTTTCCTRAAATATCAGGTGTAGGGCAGCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43606
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123047 Nonsense 1110 1286 23 27
ENSDART00000124223 Nonsense 829 1005 19 23

The following transcripts of ENSDARG00000026634 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12854510)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14555684
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATGCCTGCTCCTGCTGGAGAACCTGCAAAAACCGTGTGGTACAGAAC[G/T]GACTGAGGTAAGTCAGGTTCACTTAAGATTTTCAGCAGCTGTTGGGTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13273
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123047 Nonsense 1160 1286 25 27
ENSDART00000124223 Nonsense 879 1005 21 23

The following transcripts of ENSDARG00000026634 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12852532)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14553706
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGAGATCATCTCTGACGCCGAAGCAGATGTCAGAGAGAATGACTCCTA[T/A]CTTTTCAGTCTGGACAGCAAGGTATCGCCGTCCTCCCTTTCAAAATCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link