ehmt1b

Ensembl ID:
ENSDARG00000026634
ZFIN ID:
ZDB-GENE-080515-3
Description:
euchromatic histone-lysine N-methyltransferase 1b [Source:RefSeq peptide;Acc:NP_001166035]
Human Orthologue:
EHMT1
Human Description:
euchromatic histone-lysine N-methyltransferase 1 [Source:HGNC Symbol;Acc:24650]
Mouse Orthologue:
Ehmt1
Mouse Description:
euchromatic histone methyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1924933]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17604 Essential Splice Site Available for shipment Available now
sa7953 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13273 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17604
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123047 Essential Splice Site 432 1286 8 27
ENSDART00000124223 Essential Splice Site 151 1005 4 23

The following transcripts of ENSDARG00000026634 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 12865459)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAGGAAACGCAAGAGGAAATGGAAAGCAAAAACGGACAAGGTTTCTGG[T/A]GAGAGTTTAAATGCATGTTTTCCTRAAATATCAGGTGTAGGGCAGCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7953
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123047 Essential Splice Site 719 1286 13 27
ENSDART00000124223 Essential Splice Site 438 1005 9 23

The following transcripts of ENSDARG00000026634 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 12862256)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCTAAAGAAACTCYGCAAAGTGTCCTGCTGGCTYTAGATGCTGAAAAG[T/A]AAGAAAACCATCTATTACAACTGYTTAATTTAGCRCCTTTTTCRCTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13273
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123047 Nonsense 1160 1286 25 27
ENSDART00000124223 Nonsense 879 1005 21 23

The following transcripts of ENSDARG00000026634 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 12852532)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGAGATCATCTCTGACGCCGAAGCAGATGTCAGAGAGAATGACTCCTA[T/A]CTTTTCAGTCTGGACAGCAAGGTATCGCCGTCCTCCCTTTCAAAATCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7zij4xis