gmds

Ensembl ID:
ENSDARG00000026629
ZFIN ID:
ZDB-GENE-050419-45
Description:
GDP-mannose 4,6 dehydratase isoform 1 [Source:RefSeq peptide;Acc:NP_001095945]
Human Orthologue:
GMDS
Human Description:
GDP-mannose 4,6-dehydratase [Source:HGNC Symbol;Acc:4369]
Mouse Orthologue:
Gmds
Mouse Description:
GDP-mannose 4, 6-dehydratase Gene [Source:MGI Symbol;Acc:MGI:1891112]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6636 Nonsense Mutation detected in F1 DNA During 2017
sa6635 Nonsense Mutation detected in F1 DNA During 2017
sa43452 Nonsense Mutation detected in F1 DNA During 2017
sa37043 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6636
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046764 Nonsense 4 370 1 11
ENSDART00000103234 Nonsense 4 377 1 12
ENSDART00000143267 Nonsense 4 91 1 3
ENSDART00000146326 Nonsense 4 257 1 8
Genomic Location (Zv9):
Chromosome 20 (position 26852011)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26923314
KASP Assay ID:
554-5317.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACAYACACTCGGTCAGAACAGAAACCCGCTCCAGAGAATGGCTCAGTG[T/A]ACAGCAACGACGACTGGTGGCGGTATGAACGGAGACAGCAAGAGGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6635
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046764 Nonsense 46 370 2 11
ENSDART00000103234 Nonsense 46 377 2 12
ENSDART00000143267 Nonsense 46 91 2 3
ENSDART00000146326 Nonsense 46 257 2 8
Genomic Location (Zv9):
Chromosome 20 (position 26839203)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26910506
KASP Assay ID:
554-4864.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTTTCAGGATGGGTCCTACCTGGCAGAGTTGCTCTTGGCTAAAGGTTA[T/A]GAGGTGGGTAAATCAACACAACCCTGAAAGACTTCCTACAAACAAGTCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43452
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046764 Nonsense 195 370 6 11
ENSDART00000103234 Nonsense 202 377 7 12
ENSDART00000143267   None 91 None 3
ENSDART00000146326 Nonsense 202 257 7 8
Genomic Location (Zv9):
Chromosome 20 (position 26813187)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26884490
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCTAAGCTCTATGCATACTGGATCGTTATAAACTTCAGGGAAGCCTA[T/A]AACCTCTTTGCTGTGAATGGGATCTTGTTCAATCATGAGAGTCCTAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37043
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046764 Nonsense 307 370 9 11
ENSDART00000103234 Nonsense 314 377 10 12
ENSDART00000143267   None 91 None 3
ENSDART00000146326   None 257 None 8
Genomic Location (Zv9):
Chromosome 20 (position 26758037)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26829340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTTGTTTTCAGCTGGGAGGGGAAGGATGAGAAGGAGGTGGGCCGCTG[T/A]CAGGAGACAGGAGTCATTCATGTGAGGGTTGATCCGAAATACTACCGGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link