pafah1b1b

Ensembl ID:
ENSDARG00000026595
ZFIN ID:
ZDB-GENE-040116-3
Description:
Lissencephaly-1 homolog B [Source:UniProtKB/Swiss-Prot;Acc:Q803D2]
Human Orthologue:
PAFAH1B1
Human Description:
platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa) [Source:HGNC Symbol;Acc:
Mouse Orthologue:
Pafah1b1
Mouse Description:
platelet-activating factor acetylhydrolase, isoform 1b, subunit 1 Gene [Source:MGI Symbol;Acc:MGI:10

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25167 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43704 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25167
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031470 Essential Splice Site 64 410 4 11
Genomic Location (Zv9):
Chromosome 21 (position 38274861)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39394940
KASP Assay ID:
554-7330.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGACTTTTGGAAAAGAAATGGACTTCGGTTATCAGATTACAAAAAAAG[G/A]TCAGTACAAGGATTTTATTATACAAATATATTTATATCCCTTTAAACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43704
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031470 Nonsense 284 410 8 11
Genomic Location (Zv9):
Chromosome 21 (position 38283458)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39403537
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAAGGCGGAGCTGAGGGAGCACGAGCATGTGGTGGAGTGTATCTCCTG[G/A]GCCCCTGAGAGCGCACATCCTACTATATCCGAGGCCACAGGCTCTGAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link