cdk2

Ensembl ID:
ENSDARG00000026577
ZFIN ID:
ZDB-GENE-040426-2741
Description:
cell division protein kinase 2 [Source:RefSeq peptide;Acc:NP_998571]
Human Orthologue:
CDK2
Human Description:
cyclin-dependent kinase 2 [Source:HGNC Symbol;Acc:1771]
Mouse Orthologue:
Cdk2
Mouse Description:
cyclin-dependent kinase 2 Gene [Source:MGI Symbol;Acc:MGI:104772]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14988 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14988
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036581 Essential Splice Site 65 298 2 7
Genomic Location:
Chromosome 11 (position 3286149)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCGTGAGATCTCTCTGCTAAAAGAGCTCAATCACCCTAACATAGTCAAG[T/A]ATGTGCACTGTTTATGAATTTAGTCTCAAAACCAGTGAATATTTCAATGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Asthma: Genome-wide association study identifies three new susceptibility loci for adult asthma in the Japanese population. (View Study)
  • Type 1 diabetes: A novel susceptibility locus for type 1 diabetes on Chr12q13 identified by a genome-wide association study. (View Study)
  • Vitiligo: Association analyses identify three susceptibility Loci for vitiligo in the Chinese Han population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6315dcf2