ppp4r2a

Ensembl ID:
ENSDARG00000026540
ZFIN ID:
ZDB-GENE-030131-4922
Description:
Serine/threonine-protein phosphatase 4 regulatory subunit 2-A [Source:UniProtKB/Swiss-Prot;Acc:Q6P96
Human Orthologues:
AC233280.1, PPP4R2
Human Descriptions:
protein phosphatase 4, regulatory subunit 2 [Source:HGNC Symbol;Acc:18296]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9JBK1]
Mouse Orthologue:
Ppp4r2
Mouse Description:
protein phosphatase 4, regulatory subunit 2 Gene [Source:MGI Symbol;Acc:MGI:3027896]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6727 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6727
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035693 Nonsense 201 422 7 9

The following transcripts of ENSDARG00000026540 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 10920726)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 10879528
KASP Assay ID:
554-4242.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGCAATGTAGCYACAAACGGCCTTCCTGACAGCACAGAAAGCAAAGAA[C/T]AAGCATCTGAKCAATCAGAGAGGACGGTCAAGTAAGTTTGAAATACCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link