axin1

Ensembl ID:
ENSDARG00000026534
ZFIN ID:
ZDB-GENE-000403-1
Description:
Axin-1 [Source:UniProtKB/Swiss-Prot;Acc:P57094]
Human Orthologue:
AXIN1
Human Description:
axin 1 [Source:HGNC Symbol;Acc:903]
Mouse Orthologue:
Axin1
Mouse Description:
axin 1 Gene [Source:MGI Symbol;Acc:MGI:1096327]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20109 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20109
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033369 Nonsense 205 835 2 10
Genomic Location:
Chromosome 3 (position 42963826)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGACGGAAATTCAGACTATGATGGAGGAGAACACCTACCCTTTGTTTT[T/A]AAAGTCCGACATTTACTTGGAGTACACCAGGACTGGCGGAGAGAGTCCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x2istygv