alcama

Ensembl ID:
ENSDARG00000026531
ZFIN ID:
ZDB-GENE-990415-30
Description:
CD166 antigen homolog A [Source:UniProtKB/Swiss-Prot;Acc:Q90460]
Human Orthologue:
ALCAM
Human Description:
activated leukocyte cell adhesion molecule [Source:HGNC Symbol;Acc:400]
Mouse Orthologue:
Alcam
Mouse Description:
activated leukocyte cell adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:1313266]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12510 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12510
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030138 Nonsense 261 479 6 13
ENSDART00000100180 Nonsense 206 381 5 10
ENSDART00000100184 Nonsense 290 573 6 14
ENSDART00000129400 Nonsense 260 545 6 15
Genomic Location:
Chromosome 10 (position 29430758)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGCCAGGCGGAYGGAAACCCTCCTCCTACYAGCTTCAACTTTAACATT[A/T]AGGTGAGGGACTGCCGGCAGYGTCCACAGCAACCAGACCGCTTTTAAATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Erectile dysfunction: Pilot genome-wide association search identifies potential loci for risk of erectile dysfunction in type 1 diabetes using the DCCT/EDIC study cohort. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ovzlcbku